Molecular Basis of Inheritance questions
1003 published questions with worked solutions.
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down...
- Match List I with List II List I: (A) Frederick Griffith (B) Francois Jacob & Jacque Monod (C) Har Gobind Khorana (D) Meselson &...
- Which of the following statement is correct regarding the process of replication in *E.coli*?
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
- The first phase of translation is :
- Name the enzyme that facilitates opening of DNA helix during transcription.
- If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a...
- DNA polymorphism forms the basis of :
- The process of translation of mRNA to proteins begins as soon as :
- If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to...
- In an E. Coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with...
- If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?
- Ten E.coli cells with ^ 15 N - dsDNA are incubated in medium containing ^ 14 N nucleotide. After 60 minutes, how many E.coli...
- Which of the following statement is correct regarding the process of replication in E.coli?
- Expressed Sequence Tags (ESTs) refers to :
- What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
- Unequivocal proof that DNA is the genetic material was first proposed by :
- Among eukaryotes, replication of DNA takes place in :
- Match List I with List II. List I: A. Gene 'a' B. Gene 'y' C. Gene 'i' D. Gene 'z' List II: I. -galactosidase II. Transacetylase...
- Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows...
Page 1Next
Other chapters
Alcohols, Phenols and EthersAldehydes, Ketones and Carboxylic AcidsAlternating CurrentAminesAnatomy of Flowering PlantsAncient Indian HistoryAnimal KingdomApplication of DerivativesArea Under CurveAromatic Compounds and Aryl HalidesAtomsBasic Mathematics and LogarithmBinomial TheoremBiodiversity and ConservationBiological ClassificationBiomoleculesBiotechnology and Its ApplicationsBiotechnology: Principles and ProcessesBody Fluids and CirculationBreathing and Exchange of GasesCell Cycle and Cell DivisionCell: The Unit of LifeChemical Bonding and Molecular StructureChemical Coordination and Integration