NEET questions
18092 published questions with worked solutions.
- In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m^ -2 ) yr^ -1 , what would be the GPP...
- Match List I with List II List I: (A) Citric acid cycle (B) Glycolysis (C) Electron transport system (D) Proton gradient List II:...
- Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the...
- Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
- Following are the stages of cell division : A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase...
- In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on :
- Match List I with List II : List I: (A) *Pleurobrachia* (B) Radula (C) Stomochord (D) Air bladder List II: (I) Mollusca (II)...
- Match List I with List II : List I: (A) Pons (B) Hypothalamus (C) Medulla (D) Cerebellum List II: (I) Provides additional space...
- Match List I with List II : List I: (A) -1 antitrypsin (B) Cry IAb (C) Cry IAc (D) Enzyme replacement therapy List II: (I) Cotton...
- Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. *Homo habilis* B. *Homo...
- Which of the following is not a component of Fallopian tube?
- Match List I with List II : List I: (A) Non-medicated IUD (B) Copper releasing IUD (C) Hormone releasing IUD (D) Implants List...
- Which of the following is not a natural/traditional contraceptive method?
- The flippers of the Penguins and Dolphins are the example of the
- Which of the following is not a steroid hormone?
- Match List I with List II : List I: (A) Down's syndrome (B) -Thalassemia (C) -Thalassemia (D) Klinefelter's syndrome List II: (I)...
- Match List I with List II : List I: (A) Expiratory capacity (B) Functional residual capacity (C) Vital capacity (D) Inspiratory...
- Match List I with List II : List I (Sub Phases of Prophase I): (A) Diakinesis (B) Pachytene (C) Zygotene (D) Leptotene List II...
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
- Which one of the following factors will not affect the Hardy-Weinberg equilibrium?