Practice questions
88551 published questions with worked solutions.
- Match List I with List II : List I: (A) Expiratory capacity (B) Functional residual capacity (C) Vital capacity (D) Inspiratory...
- Match List I with List II : List I (Sub Phases of Prophase I): (A) Diakinesis (B) Pachytene (C) Zygotene (D) Leptotene List II...
- Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
- Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
- The "Ti plasmid" of *Agrobacterium tumefaciens* stands for
- Given below are two statements : Statement I : In the nephron, the descending limb of loop of Henle is impermeable to water and...
- Match List I with List II : List I: (A) Lipase (B) Nuclease (C) Protease (D) Amylase List II: (I) Peptide bond (II) Ester bond...
- Match List I with List II : List I: (A) Fibrous joints (B) Cartilaginous joints (C) Hinge joints (D) Ball and socket joints List...
- Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C....
- Match List I with List II : List I: (A) Axoneme (B) Cartwheel pattern (C) Crista (D) Satellite List II: (I) Centriole (II) Cilia...
- The following are the statements about non-chordates : A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central...
- As per ABO blood grouping system, the blood group of father is B+, mother is A+ and child is O+. Their respective genotype can be...
- Match List I with List II : List I: (A) P wave (B) QRS complex (C) T wave (D) T-P gap List II: (I) Heart muscles are electrically...
- Match List I with List II : List I: (A) Exophthalmic goiter (B) Acromegaly (C) Cushing's syndrome (D) Cretinism List II: (I)...
- Given below are two statements : Statement I : Mitochondria and chloroplasts are both double membrane bound organelles. Statement...
- Match List I with List II : List I: (A) Unicellular glandular epithelium (B) Compound epithelium (C) Multicellular glandular...
- Match List I with List II related to digestive system of cockroach. List I: (A) The structures used for storing of food. (B) Ring...
- Given below are two statements : Statement I : The cerebral hemispheres are connected by nerve tract known as corpus callosum....
- Which of the following is not an attribute of a population ?
- The process of growth is maximum during :